Association result for Marker: HGVM6907935 (dbSNP:rs6545883) in data set HGVRS1158
Significance
p-value 5e-06
-log p-value (3 d.p.) 5.301
Phenotype Tuberculosis (HGVPM1044)
Study and data set GWAS of tuberculosis in Ghanain and Gambian populations (HGVST593)
Unspecified analysis(HGVRS1158)
Effect sizes
Odds ratio
OR plot odds ratio
OR value 1.2(95% CI:1.11-1.25)
OR description NULL
OR risk allele ? (frequency:0.52)
OR risk allele comment Risk Allele Frequency in Controls
Marker details
Observed alleles
5' upstream 30bp(allele seq)3' downstream 30bp
AATTGCCACAGCTCGTGAAATATTTTCTTA(A)GAGTGGTCTAGCATGATTTGGCAGTACAAC
AATTGCCACAGCTCGTGAAATATTTTCTTA(G)GAGTGGTCTAGCATGATTTGGCAGTACAAC
Genomic location Chr2:61,772,257..61,772,257 (view in genome browser: Ensembllink | UCSClink)
Mapped gene None
Marker status
and Revision History
This marker is currently ACTIVE (no revision history)
Links