Association result for Marker: HGVM5249242 (dbSNP:rs12604483) in data set HGVRS1369
Significance
p-value 7e-06
-log p-value (3 d.p.) 5.155
Phenotype HIV-1 susceptibility (HGVPM1213)
Study and data set GWAS of HIV-1 susceptibility (HGVST706)
Unspecified analysis(HGVRS1369)
Effect sizes
Undefined effect size type
Effect size value 0(95% CI not supplied)
Effect size description NULL
Effect size risk allele ? (frequency:0.3)
Effect size risk allele comment Risk Allele Frequency in Controls
Marker details
Observed alleles
5' upstream 30bp(allele seq)3' downstream 30bp
TGGTGATGACTTACCAGATAACAATAAGGC(A)TAGTGTAGAAGATAATCCGGAAGGATGCAG
TGGTGATGACTTACCAGATAACAATAAGGC(T)TAGTGTAGAAGATAATCCGGAAGGATGCAG
Genomic location Chr18:53,855,525..53,855,525 (view in genome browser: Ensembllink | UCSClink)
Mapped gene None
Marker status
and Revision History
This marker is currently ACTIVE (no revision history)
Links